Can alcoholism lead to prostatitis?

Alcohol can also increase the severity of prostate congestion. In addition to the direct effects of alcohol on the nervous system, the prostate is also very sensitive to alcohol, and it is prone to prostate disease (13). Currently, there is limited research on the effect of alcohol on prostatitis.

spandidos-publications.com - The role of ethanol in the pathogenesis of non‑bacterial ...

What is the best thing to do before bed?

Strategies include listening to relaxing music, reading a book, taking a hot bath, meditating, deep breathing, and visualization. Try out different...

Last updated Dec 2, 2021

What is the best over the counter medicine for enlarged prostate?

Saw Palmetto You can find it in pill form or as a liquid extract. A range of 100 to 960 mg daily has been used to treat enlarged prostate, but...

Last updated Oct 28, 2021

Promotion

Introduction

With the rapid development of social economies, standards are increasing and drinking alcohol has become a common social activity ( ). In this a social environment, drinking behavior is continuously increasing, and if an individual drinker suffers from a psychopathological condition, drinking can easily develop into alcohol abuse and dependence. Alcohol consumption has resulted in a series of far-reaching social and medical issues ( ). Diseases caused by alcohol abuse are attracting increasing attention from the medical community ( , ). Alcohol-associated diseases are often reported, and alcoholism is associated serious systemic system damage and causes social dysfunction and mental health disorders, resulting in a series of social and medical problems ( , ). Chronic prostatitis (CP) is a common urological disease in men. Patients typically present with pain in the lower abdomen, perineum, scrotum, penis, lumbosacral area and other areas of discomfort ( ). Numerous patients also experience different degrees of sexual dysfunction, neuropsychiatric symptoms, fatigue and insomnia. Although CP does not cause a significant threat to life, it can seriously affect the quality of life of patients, particularly for patients with mental health issues ( , ). However, the pathogenesis and pathophysiological changes that cause CP remain unclear ( , ). Currently, there are no effective drugs or methods to treat the disease, and it is imperative to identify safe and cost-effective treatments. A previous study reported that CP may be caused by changes in hormone secretion levels and immunological dysfunction ( ). Drinking is a habit closely associated with male patients. Moderate drinking is able to promote blood circulation to improve the function of the human body but a high degree of drinking can affect human health. Alcohol can also increase the severity of prostate congestion. In addition to the direct effects of alcohol on the nervous system, the prostate is also very sensitive to alcohol, and it is prone to prostate disease ( ). Currently, there is limited research on the effect of alcohol on prostatitis. In the present study, it was attempted to investigate the association of ethanol consumption and CP, where rats with CP were treated with or without ethanol, to explore the mechanism and role of alcohol CP ( ). A chronic non-bacterial prostatitis model was successfully established in rats. In conclusion, ethanol increased the inflammatory responses in the prostate of rats with non-bacterial prostatitis.

Materials and methods

Animals

Healthy male Sprague Dawley (SD) rats (n=24; age, 6–7 weeks; weight, 180–200 g), were purchased from the Animal Experimental Center of Shanghai Jiaotong University (Shanghai, China). Animal room temperature control was at 25°C, humidity control was at 60%, and 12-h light cycle was used to simulate the normal circadian physiology. Drinking water and standard food were available to animals following sterilization. The establishment of non-bacterial prostatitis model was performed as reported in a previous study ( ). The rats were injected intraperitoneally with 3 mg/ml complete Freund's adjuvant, 1mg purified prostaglandin and 0.1 ml DPT vaccine to induce non-bacterial prostatitis in rats ( , ). The Bioethics Committee of Shanghai Jiaotong University approved all animal experiments, which were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals ( ), the Ethical Certificate number was SYXK (Shanghai) 2011–0128. Rats were divided into four groups (6 rats/group): A (normal SD rats), B (ethanol-drinking rats), C (chronic non-bacterial prostatitis rats) and D (ethanol-drinking chronic non-bacterial prostatitis rats).

Blood tests

Blood was collected from heart by cardiocentesis. The white blood cells (WBC), and concentrations of IgG, serum testosterone (serum T) and dihydrotestosterone (DHT) were analyzed by Animal blood routine detector (Acon, Shanghai, China).

Preparation of rat prostate protein purification solution

A total of 10 SD rats were sacrificed, the body weight of each rat having been recorded. Following disinfection and dissection, the prostate was exposed, removed and put into iced saline. The weight of the prostate was recorded. The prostate index was the weight of prostate/body weight. The tissue was cleansed and diced, followed by homogenization. Samples were centrifuged for 30 min (20,000 × g) at 4°C. A suction tube was used to remove the upper adipose tissue, and then 3 ml supernatant was placed in cryopreservation storage. Bicinchoninic protein assay was used for protein concentration quantification (Beyotime Institute of Biotechnology, Haimen, China) and the protein was diluted to a concentration of 50 mg/ml ( ).

Hematoxylin and eosin (H&E) staining

After the rats were sacrificed, a sample of prostate was fixed in 4% formalin for 24 h then placed in 70–100% graded ethanol series the subsequent day. The prostate was embedded in paraffin followed by dehydration and was sectioned at 4 µm of thickness. The prostate sections were deparaffinized and rehydrated (100–70%), then stained with hematoxylin (15 min) and eosin (2 min) at room temperature, and observed under an inverted microscope (Nikon TS-100-F; Nikon Corporation, Tokyo, Japan) ( ).

Measurement of inflammatory factors

Why do Asians carry an umbrella?

In Asian countries, many people have a convenient tool at their disposal: They'll often use umbrellas to shield them from the sun's powerful rays....

Last updated Jul 9, 2022

How do you shrink your enlarged prostate?

The options include: Alpha blockers. These medications relax bladder neck muscles and muscle fibers in the prostate, making urination easier. ......

Last updated Apr 2, 2020

Promotion

The prostate tissue of each group was immersed in a physiological saline solution containing 0.5% Triton X-100 and homogenized in a glass homogenizer on an ice-water bath. The prostate tissue was equilibrated into 10% prostate tissue homogenate and centrifuged at 300 × g for 15 min at 4°C. The supernatant was collected according to the ELISA kit instructions to measure tumor necrosis factor (TNF)-α (catalog number ab46070; Abcam, Cambridge, UK), inducible nitric oxide synthase (iNOS) (catalog number: MBS263618; MyBioSource, Inc., San Diego, CA, USA) and total antioxidant capacity (T-AOC) kit (catalog number STA-360; Cell Biolabs, Inc., San Diego, CA, USA).

Evaluation of prostatic inflammation

Inflammatory scores ( ) were given to the prostatic tissue of rats in each group. The standard of evaluation was the ratio of the area of the lesion to the total area (5 visual fields were randomly selected from each slice). No lesion present was denoted as 0, 25% was denoted as 1 point, 50% was denoted as 2 points, 75% was denoted as 3 points and 100% was denoted as 4 points ( ).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

RT-qPCR was performed as previously described ( ), followed by the use of SYBR Premix Ex Taq II kit (catalog number RR82LR; Takara Bio, Inc., Otsu, Japan). mRNA was extracted from the prostate tissue of rats using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). PCR was performed with the following thermocycling conditions: 5 min at 95°C, followed by 40 cycles of 95°C for 30 sec, 55°C for 30 sec and 72°C for 30 sec, with a final holding step at 4C. The thermocycler used in the present study was the StepOnePlus™ Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primers were obtained from Funengbio Co. (Shanghai, China). Primers sequences were as follows: α1a-adrenoreceptor (AR), forward, TAGCCTFTCACCGACACCTG and reverse, GGAGGTCGGCCACCG; α1b-AR, forward, CTCAACCCCATCATCTACCCA and reverse, CTCAACCCCATCATCTACCCA; α1d-AR, forward, AGCGCTTCTGCGGTATCA and reverse, CAGGTAGAAGGAGCACACGG; GAPDH, forward, TCTAGACGGCAGGTCAGGTCCAC and reverse, CCACCCATGGCAAATTCCATGGCA. RT-qPCR was performed using an Applied Biosystems 7500 real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The results were analyzed using Light Cycler Software version 3.5 (Idaho Technology Inc., Salt Lake City, UT, USA). The 2−ΔΔCq method was performed to calculate the relative expression ( ).

Statistical analysis

The data are presented as the mean ± standard deviation and analyzed using GraphPad prim 6.0 (GraphPad Software, Inc., La Jolla, CA, USA). The statistical significance was determined by one-way analysis of variance followed by the least significant difference post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Body weight in each group of SD rats

As shown in , there were no significant differences in body weight among the groups.

Blood tests were performed on all rats

Compared with the normal control group A, there was no significant difference in the blood parameters of group B (P>0.05; ). There were significant differences in blood parameters between groups C, D and A, B. The total count of white blood cells (WBC), and concentrations of IgG, serum testosterone (serum T) in group C and Group D were higher compared with Group A and Group B (P<0.05). No difference in the expression of DHT, important for development and maintenance of the prostate gland and seminal vesicles, was observed among the 4 groups.

Prostate morphology in each group of rats

There was no difference in the morphology of the prostate between groups A and B. The surface of the organ was smooth, the capsules were intact without edema, there were no glandular congestions and prostatic fluids were clear ( ). In groups C and D, prostates exhibited edema and adhesions, had enlarged volume and local congestion of glands. The congestion and volume of the prostate in group D was higher than in group C ( ).

Pathological examination of the prostate

H&E staining indicated that the cells in groups A and B sections were neatly arranged, with no obvious infiltration of inflammatory cells. The epithelial cells were arranged in rows as either cubic or columnar epithelium ( ). In group C, there was hyperplasia of the prostate epithelium, infiltration of interstitial inflammatory cells, and a certain degree of interstitial edema and enlargement. Group D exhibited infiltration of inflammatory cells, while the expansion of the prostate capsule and interstitial blood vessels was marked and accompanied by glandular injury ( ).

Wet weight and index of the prostate

There were no significant differences in prostate wet weight and prostate index among the groups ( ).

Evaluation of prostatic inflammation

Inflammatory scores ( ) were given to the prostatic tissue of rats in each group ( ). The results demonstrated that there was no significant difference in inflammation between groups A and B. The inflammation scores of groups C and D were significantly higher than those of group A, and the inflammation scores of group D were significantly higher than that of group C.

Expression of inflammatory factors in prostate

What are the symptoms of a bladder fistula?

What are the symptoms of a bladder fistula? Gas coming out of your urethra (tube that drains urine from the bladder to outside the body) as you...

Last updated Oct 20, 2021

Are pumpkin seeds good for your balls?

Pumpkin seeds may help sperm quality partly because of their high zinc content. Zinc helps balance your levels of testosterone, which is important...

Last updated Aug 21, 2020

Promotion

The expression of TNF-α and iNOS in groups C and D were significantly higher than those in groups A and B. The T-AOC levels in groups C and D was significantly lower than that in group A, while the expression of T-AOC in group D was significantly lower than that in group C (P<0.05; ), which indicated that the total antioxidant capacity of group C was higher compared with group D.

mRNA expression levels of α1a-AR, α1b-AR and α1d-AR in the prostate

The mRNA expression levels of α1a-AR, α1b-AR, and α1d-AR in the prostate of each group were detected by RT-qPCR ( ). The results demonstrated that there was no significant difference in mRNA expression of α1a-AR, α1b-AR, and α1d-AR between groups A and B. While the expression of α1a-AR, α1b-AR, and α1d-AR in group C and group D were higher compared with group A and group B. Among the expression of α1a-AR, α1b-AR, and α1d-AR, the fold change of α1a-AR was most significant, which indicated that the expression of α1a-AR may be the most important subtype among the 3 genes for inflammation.

Discussion

In the present study, SD rats were injected intraperitoneally with purified prostaglandin with double immunoadjuvant to induce non-bacterial prostatitis in rats ( , ). This rat model is a good model for analyzing the effects of ethanol ( , ). The weight of the rats did not significantly differ among the groups, indicating that the body weight of the rats was stable during the experiment. However, internal changes were observed. The number of WBC, the concentration of serum T and the concentration of IgG in groups C and D were increased compared with the control (group A). Additionally, when the prostates of ethanol-exposed rats with prostatitis were removed, the prostates were damaged, and enlarged with local congestion of glands and edema. H&E staining revealed that blood vessels were outstretched and glands were damaged in group D. These results indicated that there was inflammation in rats treated with ethanol. Significant glandular changes, severe inflammatory infiltration and hyperplasia of fibrous tissue was observed in the prostates of group D. The expression of TNF-α, iNOS in group D rats were the highest, while the expression of T-AOC was much lower in group D group compared with group A. To further analyze inflammation levels, the mRNA expression levels of α1a-AR, α1b-AR, and α1d-AR were investigated via RT-qPCR ( , ). α1a-AR expression was highest in groups D, which indicated that α1a-AR may be the most important mRNA subtype in these rats. In the present study, the association between ethanol and non-bacterial prostatitis in rats was explored. The findings indicated that ethanol may accelerate the inflammatory response in arts with prostatitis, which may provide some useful information for clinical research. However, this study has limitations. For example, the detailed signaling pathways involved remain unclear, and potential target molecules that could be exploited to prevent non-bacterial prostatitis also need to be identified. Future studies should investigate the underlying mechanism and target molecules involved in non-bacterial prostatitis.

Acknowledgements

Not applicable.

Funding

The present study was supported by Youth Fund of Shanghai Municipal Commission of Health and Family Planning (grant no. 2011-Y132). Clinical research and cultivation fund of Renji Hospital (grant no. PYXJS16-009).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JY designed this study. FL and XX performed all of the experiments. LL helped to collect the data. ZW produced the figures. LC helped with the analysis and interpretation of data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The Bioethics Committee of Shanghai Jiaotong University approved all animal experiments.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

spandidos-publications.com - The role of ethanol in the pathogenesis of non‑bacterial ...

Which seeds should I eat daily?

Seeds are great sources of fiber. They also contain healthy monounsaturated fats, polyunsaturated fats and many important vitamins, minerals and...

Last updated Dec 4, 2020

Does garlic reduce DHT?

Garlic is also a rich source of selenium and vitamin B6, both of which have been shown to help to reduce the production of DHT in the body. When...

Last updated Mar 24, 2020

Promotion

Why do I hear music when I wake up?

MES occurs when you hear music even though there isn't any playing. It's a creation of the brain, but it's not a psychological problem or symptom...

Last updated Oct 19, 2021

Promotion

Does turmeric affect potassium levels?

We report a case of turmeric associated hyperkalemia as a possible cause of hyperkalemia. We also discuss the likely mechanism of action: curcumin...

Last updated Dec 5, 2018